شبكة أساتذة التربية البدنية والرياضية
عزيزي الزائر / عزيزتي الزائرة يرجي التكرم بتسجيل الدخول اذا كنت عضو معنا


الرئيسيةالرئيسية  الأحداث  اليوميةاليومية  المنشوراتالمنشورات  س .و .جس .و .ج  بحـثبحـث  مركز التحميلمركز التحميل  التسجيلالتسجيل  دخول  

أهلا وسهلا بكم في شبكة أساتذة التربية البدنية والرياضية موضع مميز

أهلا وسهلا بك في شبكة أساتذة التربية البدنية والرياضية
أهلا وسهلا بك زائرنا الكريم، إذا كانت هذه زيارتك الأولى للمنتدى، فيرجى التكرم بزيارة صفحة التعليمـــات، بالضغط هنا.كما يشرفنا أن تقوم بالتسجيل بالضغط هنا إذا رغبت بالمشاركة في المنتدى، أما إذا رغبت بقراءة المواضيع والإطلاع فتفضل بزيارة القسم الذي ترغب أدناه.

شبكة أساتذة التربية البدنية والرياضية :: مذكرات ووثائق التربية البدنية و الرياضة :: وثائق خاصة لمادة التربية البدنية والرياضية :: قسم خاص لتدعيم معلوماتك

شاطر

8/24/2016, 19:04
المشاركة رقم:
مؤسس الموقع
مؤسس الموقع

avatar

إحصائية العضو

الجنس الجنس : ذكر
الدولة الدولة : الجزائر
الهواية الهواية : الركض
المزاج المزاج : ممتازه
المتصفح المتصفح : firefox
عدد المساهمات عدد المساهمات : 622
نقاط نقاط : 1880
التقييم التقييم : 79
تاريخ التسجيل تاريخ التسجيل : 08/04/2016
الاوسمة الاوسمة : مؤسس الموقع
مُساهمةموضوع: المنشطات الرياضية الجزء 20


المنشطات الرياضية الجزء 20


المنشطات الرياضية الجزء 20

الجينات والرياضة

لقد شاء الله الخالق أن يكون أكبر سر من أسرار الحياة ضمن ما يسمى المادة الوراثية الموجودة في كل خلية من خلايا الجسم. وبشكل أدق فان هذه المعلومات والأسرار وضعت داخل نواة الخلية التي لا يمكن رؤيتها الا تحت المجهر بعد تكبيرها آلاف المرات. أما المادة الوراثية نفسها فهي موجودة على شكل خيوط رفيعة متطاولة ومتناثرة ضمن النواة ، والتي يطلق عليها الحمض النووي ( DNA ) ، وعددها يختلف من كائن حي الى آخر ، فهي في خلية الانسان ستة واربعون كروموزوما، وأنها مكونة من (3.2)بليون جزيء وكل جزيء يمثله عنصر من العناصر المعروفة ( أدينين ، سايتوسين، غوانين ، ثايمين ) والتي يرمز لها بالرموز التالية
( A,C,G,T ) ، على التوالي، ولو ان هذه المليارات من الجزيئات كتبت بخط مستقيم ( TCCTGGTCTTAAGGGCTCAAA ) فان هذا الخط سيمتد الى مسافة تقدر بخمسة آلاف كيلومتر. ولو أردنا كتابة المعلومات الوراثية الموجودة في خلية واحدة من خلايا جسمنا فإننا نحتاج الى مليون ونصف المليون صفحة من القطع العادي.وقد اتفق العلماء على تسمية هذا الترتيب للعناصر الوراثية بالشيفرة الوراثية، والتي من الممكن للعلماء قراءتها ولكن من المستحيل التوصل الى الفهم الصحيح والتام لهذه الكتابة فيما يخص كيفية عمل المورثات وتفاعلها مع بعضها البعض.
ولذلك فان أعظم انجاز علمي عرفته الانسانية في تاريخها الطويل هو حل الشيفرة الوراثية، مما يجعل عالم الغد مختلفا كل الاختلاف عما عرفه الانسان الى وقتنا الحاضر. وهذا التطور الهائل يضع ثلاث مسائل على سلم أولوياته المطروحة ، وهي :
1 - موضوع معالجة جميع الأمراض والعاهات الوراثية ، والذي سيكون ممكنا في المستقبل القريب، ولذلك علينا أن نتصور مجتمعا خاليا من الأمراض.
2 - تعريف وتحديد بشكل دقيق للمرض الوراثي الذي يجب تصحيحه .
3 - واستكمالا للنقطة الثانية ، يبرز موضوع امكانية تحسين وتطوير العرق البشري باستخدام الطرق العلمية، كتغيير لون الجلد والعينين والقامة والامكانيات العضلية والجسدية.
ان ما يخشاه البعض هو ان أول من سيستخدمون طرق المعالجة الوراثية هم الرياضيون، وليس المرضى الحقيقيون، لأنهم بحاجة الى مثل تلك المعالجة لإزالة بعض العيوب التي تقلل من فرص الفوز أو تنشيط عوامل جسمية تزيد من نسبة فوزهم.
فهناك مثلا مرض تصلب الشرايين الطرفية ( peripheral atherosclerotic disease ) المتمثل بتقلص وانكماش الأوعية الدموية التي تغذي الأطراف العلوية والسفلية من الجسم ، وهذا المرض قد يؤدي أحيانا الى فقدان الأطراف المصابة ، ويحاول الأطباء استخدام طرائق المعالجة الوراثية لمكافحة هذا المرض عن طريق ادخال نسخة سليمة من مورثة خاصة الى تلك الأوعية الدموية تعمل على توسيعها ، وتؤدي الى تحسين الاداء الرياضي.
وبفضل التقنيات الحديثة ، قد يبدو ممكنا أيضا استخدام المورثة المسؤولة عن تصنيع هرمون ارثروبيوتين ( E.P.O. ) الذي يؤدي الى ازدياد كريات الدم الحمراء في الجسم ، الأمر الذي يمكنها من حمل كمية كبيرة من الأكسجين الذي يحتاج اليه الجسم مما يؤدي الى تحسن في الأداء الرياضي.
ومثل هذا الغش لا يمكن الكشف عنه بأي وسيلة - على الأرجح - لأن كل البشر لديهم نفس المورثات الجينية.وبالتالي لا يمكن تجريم الرياضي بقصد الغش أو زيادة القدرة الجسمية بشكل غير قانوني.
ولذلك فقد أظهرت اللجنة الأوليمبية الدولية ومنظمات رياضية أخرى في السنوات الأخيرة قلقاً عميقاً إزاء احتمالات إساءة استخدام تكنولوجيا تحويل الجينات. لكن عالم الرياضة يبدو عازماً على المضي قدماً في استغلال هذه التكنولوجيا سعياً إلى الحصول على الميداليات الذهبية والبطولات. وعلى اللجان الرياضية التي كانت تعتمد خلال السنوات الماضية لكشف الغش في استخدام المواد الكيميائية المحظورة على يد أبرع علماء الكيمياء ، نبحث الآن عن اقدر الخبراء في مجال علم الوراثة ، وتعد هذه النقطة نقطة انعطاف من حيز الكيمياء الى حيز البيولوجيا، ومن هنا فمن المنتظر أن تكون الاختبارات الجينية موجة المستقبل.
الجدير بالذكر أنه وفي العام 2003 أصدرت الوكالة العالمية لمناهضة المنشطات (WADA) قراراً بحظر تنشيط الجينات، لكن بعض العلماء توقعوا ظهور حالات إساءة استعمال المنشطات الجينية في دورات للألعاب الأوليمبية في الاعوام المقبلة .

الصيدلاني راتب الحنيطي
المصدر : الحنيطي، راتب : كتاب المنشطات الرياضية




توقيع : Admin




قم بوضع تعليق ليعبر عن رأيك في الموضوع مع التزام الشروط:
1-عدم السب او الشتم
2-عدم وضع روابط لمواقع اخرى
3-عدم كتابة اكثر من تعليق بنفس المحتوى
4-يتم الاشراف على كل تعليق قبل نشره
5-عدم الخروج خارج الموضوع ونطاق المنتدى
ـــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــــ







الــرد الســـريـع
..



الذين يشاهدون محتوى الموضوع الآن : 20 ( الأعضاء 3 والزوار 17)



تعليمات المشاركة
صلاحيات هذا المنتدى:
لاتستطيع الرد على المواضيع في هذا المنتدى

BB code is متاحة
كود [IMG] متاحة
كود HTML معطلة

Back to Top

اهلا بك زائرنا الكريم

لأننا نعتز بك .. ولأننا نفخر بوجودك معنا.. نحن ندعوك للتسجيل معنا في مجتمعنا ولتكون أحد أفراد عائلتنا الودودة فهل ستقبل دعوتنا ؟ عملية التسجيل سهلة جدا ولن تستغرق من وقتك سوى أقل من دقيقة
أدوات الموضوع: رفع الصور رفع الملفات رفع فيديو أغانى فوتوشوب ترجمة كيبورد ردود كتابية ومصورة
اشترك في القائمة البريدية ليصلك جديدنا :